|  Help  |  About  |  Contact Us

Allele : Nup62cl<em1(IMPC)J> nucleoporin 62 C-terminal like; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:7330226 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Nup62cl
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AAGGACTTCATATCTCTAGA and AGATTGGAGAATCTCCCCAC, which resulted in a 3283 bp deletion beginning at Chromosome X position 140,025,108 bp and ending after 140,028,390 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000653522, ENSMUSE00000653521, ENSMUSE00000653519 and ENSMUSE00000653518 (exons 4-7) and 2835 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 71 and early truncation 6 amino acids later.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

3 Publication categories