| Primary Identifier | MGI:7330226 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Nup62cl |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AAGGACTTCATATCTCTAGA and AGATTGGAGAATCTCCCCAC, which resulted in a 3283 bp deletion beginning at Chromosome X position 140,025,108 bp and ending after 140,028,390 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000653522, ENSMUSE00000653521, ENSMUSE00000653519 and ENSMUSE00000653518 (exons 4-7) and 2835 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 71 and early truncation 6 amino acids later. |