|  Help  |  About  |  Contact Us

Allele : Smim22<em1(IMPC)J> small integral membrane protein 22; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:7345511 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Smim22
Inheritance Mode  Not Specified Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GACTGTGTACGGCCAGAAAG and ACTGTGTTCTAATCCCGCCA, which resulted in a 643 bp deletion beginning at Chromosome 16 position 5,007,697 bp and ending after 5,008,339 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000997341, ENSMUSE00001018238, and ENSMUSE00001086134 (exons 2,3,4) and 296 bp of flanking intronic sequence including the start site, splice acceptor and donor and is predicted to result in a null allele.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

2 Publication categories