| Primary Identifier | MGI:7336233 | Allele Type | Endonuclease-mediated |
| Attribute String | Not Specified | Gene | Cenpa |
| Strain of Origin | C57BL/6N | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Serine codon 62 (AGC) in exon 2 was changed to alanine (p.S62A) using an sgRNA (targeting GGAACTTACAACCATGCTGA) and an ssODN template with CRISPR/Cas9 technology. This mutation is the equivalent of the human p.S68A mutation and prevents phosphorylation of the residue. |
