| Primary Identifier | MGI:7346396 | Allele Type | Endonuclease-mediated |
| Attribute String | Modified regulatory region, Null/knockout | Gene | Fmn1 |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | Grem1 limb regulatory region Rr285 (CRM2), located in Fmn1 intron 15 [in reference to ENSMUST00000081349], was targeted with sgRNAs (targeting AGCGGCAGTTCGGCTTCCGG and TCTCATACGATCCAGGAGAA) using CRISPR/Cas9 technology, resulting in a 9.9 kb deletion (chr2:113519948-113529818 GRCm39) from intron 14 to 15 (so including exon 15). |
