| Primary Identifier | MGI:7346400 | Allele Type | Endonuclease-mediated |
| Attribute String | Modified regulatory region | Gene | Rr287 |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | This Grem1 limb regulatory region, located in Fmn1 intron 12 [in reference to ENSMUST00000081349], was targeted with sgRNAs (targeting CTTGTAATGCTAGGACGGCC and AGTCAAGGACACACCTGTA) using CRISPR/Cas9 technology, resulting in a 2.8 kb deletion (chr2:113434105-113436917 GRCm39). |