| Primary Identifier | MGI:7346401 | Allele Type | Endonuclease-mediated |
| Attribute String | Modified regulatory region | Gene | Rr26 |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | This Grem1 limb regulatory region, located in Fmn1 intron 13 [in reference to ENSMUST00000081349], was targeted with sgRNAs (targeting CACCGCAGCCTATAATTCTCAGCGC and AAACGCGCTGAGAATTATAGGCTGC) using CRISPR/Cas9 technology, resulting in a 1.1 kb deletion (chr2:113470863-113471933 GRCm39). |