|  Help  |  About  |  Contact Us

Allele : Rr26<em1Zllr> regulatory region 26; endonuclease-mediated mutation 1, Rolf Zeller

Primary Identifier  MGI:7346401 Allele Type  Endonuclease-mediated
Attribute String  Modified regulatory region Gene  Rr26
Is Recombinase  false Is Wild Type  false
molecularNote  This Grem1 limb regulatory region, located in Fmn1 intron 13 [in reference to ENSMUST00000081349], was targeted with sgRNAs (targeting CACCGCAGCCTATAATTCTCAGCGC and AAACGCGCTGAGAATTATAGGCTGC) using CRISPR/Cas9 technology, resulting in a 1.1 kb deletion (chr2:113470863-113471933 GRCm39).
  • mutations:
  • Intragenic deletion
  • synonyms:
  • CRM4<delta>,
  • CRM4<delta>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

3 Publication categories

Trail: Allele