| Primary Identifier | MGI:7346375 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Cimip5 |
| Inheritance Mode | Not Specified | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGTCTGACCGCATAACCATG and GGACCCTGAGTTCTCCACCA, which resulted in a 4969 bp deletion beginning at Chromosome 12 position 17,006,818 bp and ending after 17,011,786 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000615977, ENSMUSE00000615976, ENSMUSE00000615975, and ENSMUSE00000615974 (exons 1-4) and 4212 bp of flanking intronic sequence including the start site, splice acceptor and donor and is predicted to result in a null allele. |
