|  Help  |  About  |  Contact Us

Allele : Cimip5<em1(IMPC)J> ciliary microtubule inner protein 5; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:7346375 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Cimip5
Inheritance Mode  Not Specified Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGTCTGACCGCATAACCATG and GGACCCTGAGTTCTCCACCA, which resulted in a 4969 bp deletion beginning at Chromosome 12 position 17,006,818 bp and ending after 17,011,786 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000615977, ENSMUSE00000615976, ENSMUSE00000615975, and ENSMUSE00000615974 (exons 1-4) and 4212 bp of flanking intronic sequence including the start site, splice acceptor and donor and is predicted to result in a null allele.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

2 Publication categories

Trail: Allele