| Primary Identifier | MGI:7339001 | Allele Type | Endonuclease-mediated |
| Attribute String | Modified regulatory region | Gene | Rr266 |
| Strain of Origin | C57BL/6J | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | The GG2-GG1/A2-C1 enhancer element of the Ins1 promoter was targeted with sgRNAs (targeting CTTTCTGCAGACCTAGCACCAGG and AAACTGCAGCTTCAGCCCCTCTGG) using CRISPR/Cas9 technology, resulting in a 2 bp deletion (CC) in the C1 element. |