| Primary Identifier | MGI:7339039 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence | Gene | Ryr1 |
| Strain of Origin | C57BL/6J | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Starting at glutamine codon 1971 in exon 36, sequence CA was replaced with ACAGCT (effectively a 4-bp insertion) using an sgRNA (targeting AAGATGCAGGGCAACCAGCGGGG ) and an ssODN template with CRISPR/Cas9 technology, resulting in a frameshift and premature stop codon (ENSMUSP00000137123:p.Q1971Tfs*49). The mutation mimics the similar human c.5908C>T:p.Q1970* and c.5938delC:p.L1980Sfs*1 premature stop codon mutations associated with congenital myopathy 1B (multiminicore disease (MmD)). |
