|  Help  |  About  |  Contact Us

Allele : Mt4<em1(IMPC)J> metallothionein 4; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:7378844 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Mt4
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCTTCCTTAACACTATGGCA and ACCGGAACCCCACTCACACG, which resulted in a 2150 bp deletion beginning at Chromosome 8 position 94,136,987 bp and ending after 94,139,136 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000635105, ENSMUSE00000212736, and ENSMUSE00000635102 (exons 1-3) and 1752 bp of flanking intronic sequence including the start site, splice acceptor and donor and is predicted to result in a null allele.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

2 Publication categories