|  Help  |  About  |  Contact Us

Allele : Cgas<em1Bge> cyclic GMP-AMP synthase; endonuclease-mediated mutation 1, Baoxue Ge

Primary Identifier  MGI:7484367 Allele Type  Endonuclease-mediated
Attribute String  Not Specified Gene  Cgas
Strain of Origin  C57BL/6J Is Recombinase  false
Is Wild Type  false
molecularNote  Glutamic acid codon 176 (GAA) was changed to alanine (GCA) (p.E176A) using a sgRNA and an ssODN template (AAACGCAAAGATATCTCGGAGGCGGCCGAGACGGTGAATAAAGTTGTTGCACGCCTGCTGCGCAGAATGCAGAAACGGGAGTCGGAGTTCAAAGGT) with CRISPR/Cas9 technology. This mutation blocks PARylation (poly(ADP) ribosylation) of the residue in the encoded peptide.
  • mutations:
  • Single point mutation
  • synonyms:
  • Cgas<E176A>,
  • Cgas<E176A>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories

Trail: Allele