|  Help  |  About  |  Contact Us

Allele : Scn11a<em1Nju> sodium channel, voltage-gated, type XI, alpha; endonuclease-mediated mutation 1, Model Animal Research Center of Nanjing University

Primary Identifier  MGI:7484377 Allele Type  Endonuclease-mediated
Attribute String  Humanized sequence Gene  Scn11a
Strain of Origin  C57BL/6 Is Recombinase  false
Is Wild Type  false
molecularNote  Arginine codon 222 (CGT) was changed to serine (AGC) (p.R222S) using an sgRNA (targeting CAGAGCTCTCAACACTCGGAAGG) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the human p.R222S mutation associated with familial episodic pain syndrome (FEPS).
  • mutations:
  • Nucleotide substitutions
  • synonyms:
  • Scn11a<R222S>,
  • Scn11a<R222S>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories