| Primary Identifier | MGI:7484377 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence | Gene | Scn11a |
| Strain of Origin | C57BL/6 | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Arginine codon 222 (CGT) was changed to serine (AGC) (p.R222S) using an sgRNA (targeting CAGAGCTCTCAACACTCGGAAGG) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the human p.R222S mutation associated with familial episodic pain syndrome (FEPS). |