|  Help  |  About  |  Contact Us

Allele : Adar<em2Qwan> adenosine deaminase, RNA-specific; endonuclease-mediated mutation 2, Qingde Wang

Primary Identifier  MGI:7484719 Allele Type  Endonuclease-mediated
Attribute String  Humanized sequence Gene  Adar
Is Recombinase  false Is Wild Type  false
molecularNote  Proline codon 195 was changed to alanine (c.583C>G p.P195A) using an sgRNA (targeting GCAAGGCAAGCTTCGCACCA) and an ssODN template with CRISPR/Cas9 technology. This mutation is the equivalent of the human p.P193A mutation associated with Aicardi-Goutieres syndrome (AGS).
  • mutations:
  • Single point mutation
  • synonyms:
  • Adar<P193A>,
  • Adar<P193A>,
  • ADAR1 P195A,
  • ADAR1 P195A
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

4 Publication categories