|  Help  |  About  |  Contact Us

Allele : Rr313<em1Vmc> regulatory region 313; endonuclease-mediated mutation 1, Vincent M Christoffels

Primary Identifier  MGI:7380440 Allele Type  Endonuclease-mediated
Attribute String  Modified regulatory region Gene  Rr313
Strain of Origin  FVB/NRj Is Recombinase  false
Is Wild Type  false
molecularNote  The cardiac Cacna1g and Epn3 enhancer, located in an intron of Cacna1g, was targeted with sgRNAs (targeting GGGCACATCCCTCAGCAGCC and GGCCAACCTCTCACTGCTGA) using CRISPR/Cas9 technology, resulting in a 1760 bp deletion.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • RE4<->,
  • RE4<->
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories