| Primary Identifier | MGI:7380441 | Allele Type | Endonuclease-mediated |
| Attribute String | Modified regulatory region | Gene | Rr314 |
| Strain of Origin | FVB/NRj | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | The cardiac Cacna1g and Epn3 enhancer, located in an intron of Cacna1g, was targeted with sgRNAs (targeting GGCCAACCTCTCACTGCTGA and GGCCCAATTAGAAGCCACCC) using CRISPR/Cas9 technology, resulting in a 1604 bp deletion. |