| Primary Identifier | MGI:7380442 | Allele Type | Endonuclease-mediated |
| Attribute String | Modified regulatory region | Gene | Del(11Rr313-Rr314)5Vmc |
| Strain of Origin | FVB/NRj | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | The adjacent cardiac Cacna1g and Epn3 enhancers, located in an intron of Cacna1g, were targeted with sgRNAs (targeting GGGCACATCCCTCAGCAGCC and GGCCCAATTAGAAGCCACCC) using CRISPR/Cas9 technology, resulting in a 3345 bp deletion. |