|  Help  |  About  |  Contact Us

Allele : Rr295<em1Hzo> regulatory region 295; endonuclease-mediated mutation 1, Huda Y Zoghbi

Primary Identifier  MGI:7356640 Allele Type  Endonuclease-mediated
Attribute String  Modified regulatory region Gene  Rr295
Is Recombinase  false Is Wild Type  false
molecularNote  The Mecp2 enhancer in intron 1 was targeted with sgRNAs (targeting ACATGCACAAACCCAAACAT and TGATAAGTGTGATTCATGAG) using CRISPR/Cas9 technology, resulting in an 1154 bp deletion.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Peak-2<KO>,
  • Peak-2<KO>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

3 Publication categories