|  Help  |  About  |  Contact Us

Allele : Rr296<em1Hzo> regulatory region 296; endonuclease-mediated mutation 1, Huda Y Zoghbi

Primary Identifier  MGI:7356641 Allele Type  Endonuclease-mediated
Attribute String  Modified regulatory region Gene  Rr296
Is Recombinase  false Is Wild Type  false
molecularNote  The Mecp2 silencer 31 kb upstream of the gene was targeted with sgRNAs (targeting AAAAGGATATGGGATACTAG and GGTCCCCAATAGGGTCACCA) using CRISPR/Cas9 technology, resulting in a 1440 bp deletion.
  • mutations:
  • Intergenic deletion
  • synonyms:
  • Peak-6<KO>,
  • Peak-6<KO>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

3 Publication categories