| Primary Identifier | MGI:7343552 | Allele Type | Endonuclease-mediated |
| Attribute String | Reporter | Gene | Yap1 |
| Strain of Origin | CD-1 | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | CRISPR/Cas9 methodologies use a gRNA (TCACGTGGTTATAGAGCTGCAGG) spanning the Stop TAG codon to introduce a fluorescent protein fused to the endogenous gene. EmiRFP670 (derived from miRFP670) is a constitutive, enhanced, monomeric, near-infrared protein whose emission maximum is 670 nm. The donating laboratory confirmed that a single copy of the fusion reporter was integrated. |
