|  Help  |  About  |  Contact Us

Allele : Yap1<em1Jrt> yes-associated protein 1; endonuclease-mediated mutation 1, Janet Rossant

Primary Identifier  MGI:7343552 Allele Type  Endonuclease-mediated
Attribute String  Reporter Gene  Yap1
Strain of Origin  CD-1 Is Recombinase  false
Is Wild Type  false
molecularNote  CRISPR/Cas9 methodologies use a gRNA (TCACGTGGTTATAGAGCTGCAGG) spanning the Stop TAG codon to introduce a fluorescent protein fused to the endogenous gene. EmiRFP670 (derived from miRFP670) is a constitutive, enhanced, monomeric, near-infrared protein whose emission maximum is 670 nm. The donating laboratory confirmed that a single copy of the fusion reporter was integrated.
  • mutations:
  • Insertion
  • synonyms:
  • YAP-emiRFP670,
  • YAP-emiRFP670
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

3 Publication categories

Trail: Allele