|  Help  |  About  |  Contact Us

Allele : Ret<em2Heno> ret proto-oncogene; endonuclease-mediated mutation 2, Hideki Enomoto

Primary Identifier  MGI:7484390 Allele Type  Endonuclease-mediated
Attribute String  Humanized sequence Gene  Ret
Strain of Origin  C57BL/6N Is Recombinase  false
Is Wild Type  false
molecularNote  Tyrosine codon 792 (TAT) was changed to phenylalanine (TTT) (p.Y792F) using an sgRNA (targeting ACATGTCATCAAGTTGTATGGGG) and an ssODN template with CRISPR/Cas9 technology. This mutation is the equivalent of the human p.Y791F mutation associated with Hirschsprung disease (HSCR).
  • mutations:
  • Single point mutation
  • synonyms:
  • Ret<Y792F>,
  • Ret<Y792F>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories