| Primary Identifier | MGI:7484390 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence | Gene | Ret |
| Strain of Origin | C57BL/6N | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Tyrosine codon 792 (TAT) was changed to phenylalanine (TTT) (p.Y792F) using an sgRNA (targeting ACATGTCATCAAGTTGTATGGGG) and an ssODN template with CRISPR/Cas9 technology. This mutation is the equivalent of the human p.Y791F mutation associated with Hirschsprung disease (HSCR). |
