| Primary Identifier | MGI:7484674 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence | Gene | Clp1 |
| Strain of Origin | (C57BL/6J x SJL/J)F1 | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Arginine codon 140 (CGT) in exon 2 was changed to histidine (CAT) (c.419G>A p.R140H) using an sgRNA (targeting AACGCACTGCGTAGTTGAGT) and an ssODN template with CRISPR/Cas9 technology. The equivalent human mutation is associated with pontocerebellar hypoplasia type 10 (PCH10). |
