|  Help  |  About  |  Contact Us

Allele : Clp1<em1Schaf> CLP1, cleavage and polyadenylation factor I subunit; endonuclease-mediated mutation 1, Ashleigh Schaffer

Primary Identifier  MGI:7484674 Allele Type  Endonuclease-mediated
Attribute String  Humanized sequence Gene  Clp1
Strain of Origin  (C57BL/6J x SJL/J)F1 Is Recombinase  false
Is Wild Type  false
molecularNote  Arginine codon 140 (CGT) in exon 2 was changed to histidine (CAT) (c.419G>A p.R140H) using an sgRNA (targeting AACGCACTGCGTAGTTGAGT) and an ssODN template with CRISPR/Cas9 technology. The equivalent human mutation is associated with pontocerebellar hypoplasia type 10 (PCH10).
  • mutations:
  • Single point mutation
  • synonyms:
  • Clp1<R140H>,
  • Clp1<R140H>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories

Trail: Allele