|  Help  |  About  |  Contact Us

Allele : Fbxo48<em1(IMPC)J> F-box protein 48; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:7356592 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Fbxo48
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTGTGACTCTGTTAGCTCGA and TTAAACTTGATCTAATCTTG, which resulted in a 1972 bp deletion beginning at Chromosome 11 position 16,952,904 bp and ending after 16,954,875 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000442598, ENSMUSE00000344823, and ENSMUSE00000388108 (exons 2,3,and 4) and 910 bp of flanking intronic sequence including the start site, splice acceptor and donor and is predicted to result in a null allele.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

3 Publication categories