| Primary Identifier | MGI:7356592 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Fbxo48 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTGTGACTCTGTTAGCTCGA and TTAAACTTGATCTAATCTTG, which resulted in a 1972 bp deletion beginning at Chromosome 11 position 16,952,904 bp and ending after 16,954,875 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000442598, ENSMUSE00000344823, and ENSMUSE00000388108 (exons 2,3,and 4) and 910 bp of flanking intronic sequence including the start site, splice acceptor and donor and is predicted to result in a null allele. |