| Primary Identifier | MGI:7356594 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Myo1b |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ACAGCATCTCCTTCCAGAGA and GAGGCTCTTAGAATACCCAG, which resulted in a 190 bp deletion beginning at Chromosome 1 position 51,834,418 bp and ending after 51,834,607 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001207134 (exon 4) and 95 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 84 and early truncation 44 amino acids later. |
