| Primary Identifier | MGI:7356629 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Gpn1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ATTCTTCCTGGGGTACTACT and TGACGTGGAGAAACTTTCAG, which resulted in a 2433 bp deletion beginning at Chromosome 5 position 31,497,093 bp and ending after 31,499,525 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001228555, ENSMUSE00001229512, and ENSMUSE00001247942 (exons 3,4, and 5) and 2282 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 69 and early truncation 2 amino acids later. |