|  Help  |  About  |  Contact Us

Allele : Gpn1<em1(IMPC)J> GPN-loop GTPase 1; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:7356629 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Gpn1
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ATTCTTCCTGGGGTACTACT and TGACGTGGAGAAACTTTCAG, which resulted in a 2433 bp deletion beginning at Chromosome 5 position 31,497,093 bp and ending after 31,499,525 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001228555, ENSMUSE00001229512, and ENSMUSE00001247942 (exons 3,4, and 5) and 2282 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 69 and early truncation 2 amino acids later.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Gpn1<->,
  • Gpn1<->
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

4 Publication categories

Trail: Allele