| Primary Identifier | MGI:7341373 | Allele Type | Endonuclease-mediated |
| Attribute String | Modified regulatory region | Gene | Rr272 |
| Strain of Origin | C57BL/6J | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | This Vsx2 enhancer was targeted with sgRNAs (GUUAGACCUAGUCAGAACUC and GUCUAGCUUGUGGAUUUCUU) and an ssODN template using CRISPR/Cas9 technology, resulting in a 11,634 bp deletion (chr12:84578824-84590457 GRCm39) that contains evolutionary conserved regions Rr273 and Rr274. |