|  Help  |  About  |  Contact Us

Allele : Rr272<em2Mad> regulatory region 272; endonuclease-mediated mutation 2, Michael A Dyer

Primary Identifier  MGI:7341373 Allele Type  Endonuclease-mediated
Attribute String  Modified regulatory region Gene  Rr272
Strain of Origin  C57BL/6J Is Recombinase  false
Is Wild Type  false
molecularNote  This Vsx2 enhancer was targeted with sgRNAs (GUUAGACCUAGUCAGAACUC and GUCUAGCUUGUGGAUUUCUU) and an ssODN template using CRISPR/Cas9 technology, resulting in a 11,634 bp deletion (chr12:84578824-84590457 GRCm39) that contains evolutionary conserved regions Rr273 and Rr274.
  • mutations:
  • Intergenic deletion
  • synonyms:
  • R0-37-R1-28 delta,
  • R0-37-R1-28 delta
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

3 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

3 Publication categories