|  Help  |  About  |  Contact Us

Allele : Rasgef1c<em1(IMPC)J> RasGEF domain family, member 1C; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:7356585 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Rasgef1c
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCTTATCCGCAGAATCACAG and GTCCACTTTCACCTGTCTGG, which resulted in a 2685 bp deletion beginning at Chromosome 11 position 49,966,962 bp and ending after 49,969,646 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001287950 and ENSMUSE00001274105 (exons 7 and 8) and 2492 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 238 and early truncation 2 amino acids later.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

2 Publication categories