|  Help  |  About  |  Contact Us

Allele : Rr274<em3Mad> regulatory region 274; endonuclease-mediated mutation 3, Michael A Dyer

Primary Identifier  MGI:7341436 Allele Type  Endonuclease-mediated
Attribute String  Modified regulatory region Gene  Rr274
Strain of Origin  C57BL/6J Is Recombinase  false
Is Wild Type  false
molecularNote  This Vsx2 enhancer was targeted with sgRNAs (CCUGCCGAUAAUGCUUAAUU) and an ssODN template using CRISPR/Cas9 technology, resulting in the deletion of one of the Vsx2 consensus binding sites.
  • mutations:
  • Intergenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

3 Publication categories