| Primary Identifier | MGI:7341436 | Allele Type | Endonuclease-mediated |
| Attribute String | Modified regulatory region | Gene | Rr274 |
| Strain of Origin | C57BL/6J | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | This Vsx2 enhancer was targeted with sgRNAs (CCUGCCGAUAAUGCUUAAUU) and an ssODN template using CRISPR/Cas9 technology, resulting in the deletion of one of the Vsx2 consensus binding sites. |