| Primary Identifier | MGI:7343676 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence, Inserted expressed sequence | Gene | Stmn2 |
| Strain of Origin | C57BL/6J | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | CRISPR/cas9 endonuclease-mediated genome editing ses guide RNAs to target intron 1. A double stranded DNA plasmid donor carrying 394 nt of human intron 1 genomic DNA (including 2.0kb and 1.5kb of mouse Stmn2 intron 1 DNA flanking the 394 nt human derived genomic sequence), was used in combination with mouse Stmn2 intron 1 targeting guides CACAGAATACATATCCTCAGAGG and AAAAATATTAAGCATTCACTGGGresulting in the replacement of 479 nt of murine Stmn2 intron 1 with the human-derived replacement to generate a partially humanized mouse. |
