|  Help  |  About  |  Contact Us

Allele : Stmn2<em6(STMN2)Lutzy> stathmin-like 2; endonuclease-mediated mutation 6, Cathy Lutz

Primary Identifier  MGI:7343676 Allele Type  Endonuclease-mediated
Attribute String  Humanized sequence, Inserted expressed sequence Gene  Stmn2
Strain of Origin  C57BL/6J Is Recombinase  false
Is Wild Type  false
molecularNote  CRISPR/cas9 endonuclease-mediated genome editing ses guide RNAs to target intron 1. A double stranded DNA plasmid donor carrying 394 nt of human intron 1 genomic DNA (including 2.0kb and 1.5kb of mouse Stmn2 intron 1 DNA flanking the 394 nt human derived genomic sequence), was used in combination with mouse Stmn2 intron 1 targeting guides CACAGAATACATATCCTCAGAGG and AAAAATATTAAGCATTCACTGGGresulting in the replacement of 479 nt of murine Stmn2 intron 1 with the human-derived replacement to generate a partially humanized mouse.
  • mutations:
  • Insertion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

1 Expresses

Trail: Allele

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

2 Publication categories

Trail: Allele