| Primary Identifier | MGI:7367236 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Fitm1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTGAGGACTGACGGTCAACA and GTACGTGACTTCCATCCTGT, which resulted in a 1578 bp deletion beginning at Chromosome 14 position 55,575,498 bp and ending after 55,577,075 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000124452 and ENSMUSE00000317360 (exons 1 and 2) and 607 bp of flanking intronic sequence including the start site, splice acceptor and donor and is predicted to result in a null allele. |
