|  Help  |  About  |  Contact Us

Allele : Rr306<em1Cdon> regulatory region 306; endonuclease-mediated mutation 1, Chen Dong

Primary Identifier  MGI:7367590 Allele Type  Endonuclease-mediated
Attribute String  Modified regulatory region Gene  Rr306
Strain of Origin  C57BL/6J Is Recombinase  false
Is Wild Type  false
molecularNote  The Rorc cis-regulatory element was targeted with sgRNAs (targeting ACAAAATGTGCCCGCTCCAC, ACGGAAACGCTGAGCAGGGC and GATGATACTGCCGCTATCGT) using CRISPR/Cas9 technology, resulting in a 1,253 bp deletion.
  • mutations:
  • Intergenic deletion
  • synonyms:
  • CNS6-deficent,
  • CNS6-deficent
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories