|  Help  |  About  |  Contact Us

Allele : Cops9<em1(IMPC)J> COP9 signalosome subunit 9; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:7343892 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Cops9
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCTCTGATAAAGAGGCTAGG and CTAAACAGTAGCCATTCGGA, which resulted in a 5306 bp deletion beginning at Chromosome 1 position 92,636,893 bp and ending after 92,642,198 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001311837, ENSMUSE00001274912, and ENSMUSE00001239788 (exons 1-3) and 4868 bp of flanking and intronic sequence including the start site, splice acceptor and donor and is predicted to result in a null allele. There is a 10 bp insertion (CATCCTAAAC) 7 bp before the deletion.
  • mutations:
  • Insertion,
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

3 Publication categories