| Primary Identifier | MGI:7366910 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence | Gene | Dmrt1 |
| Strain of Origin | (FVB/NJ x B6(Cg)-Tyr<c-2J>/J)F1 | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | CRISPR/cas9 endonuclease-mediated genome editing was used to create asparagine to glycine substitution at position 109 (R109G in the mouse, R111G in human) the using Ensembl Canonical Transcript: ENSMUST00000025755.11 Dmrt1-201. The CRISPR guide sequence was CCCGCTGTCGCTCCGCAATC and the repair template was 5'-GGCCACAAGCGCTTCTGCATGTGGCGGGATTGCCAGTGCAAGAAGTGCAGTCTGATCGCGGAGGGACAGCGGGTGATGGCCGCGCAGGTGGCCCTGAGAAGACAGCAGGCCCA-3'. The repair template includes two silent changes that remove the PAM sequence and generate a restriction enzyme recognition site, as well as R109G. The R109G mutation alters the DNA binding motif. The mutation models a de novo human mutation in DMRT1 associated with dominant complete gonadal dysgenesis and 46,XY sex reversal. |