|  Help  |  About  |  Contact Us

Allele : Dmrt1<em1Zark> doublesex and mab-3 related transcription factor 1; endonuclease-mediated mutation 1, David Zarkower

Primary Identifier  MGI:7366910 Allele Type  Endonuclease-mediated
Attribute String  Humanized sequence Gene  Dmrt1
Strain of Origin  (FVB/NJ x B6(Cg)-Tyr<c-2J>/J)F1 Is Recombinase  false
Is Wild Type  false
molecularNote  CRISPR/cas9 endonuclease-mediated genome editing was used to create asparagine to glycine substitution at position 109 (R109G in the mouse, R111G in human) the using Ensembl Canonical Transcript: ENSMUST00000025755.11 Dmrt1-201. The CRISPR guide sequence was CCCGCTGTCGCTCCGCAATC and the repair template was 5'-GGCCACAAGCGCTTCTGCATGTGGCGGGATTGCCAGTGCAAGAAGTGCAGTCTGATCGCGGAGGGACAGCGGGTGATGGCCGCGCAGGTGGCCCTGAGAAGACAGCAGGCCCA-3'. The repair template includes two silent changes that remove the PAM sequence and generate a restriction enzyme recognition site, as well as R109G. The R109G mutation alters the DNA binding motif. The mutation models a de novo human mutation in DMRT1 associated with dominant complete gonadal dysgenesis and 46,XY sex reversal.
  • mutations:
  • Nucleotide substitutions
  • synonyms:
  • Dmrt1<R111G>,
  • Dmrt1<R111G>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

2 Publication categories