| Primary Identifier | MGI:7366921 | Allele Type | Endonuclease-mediated |
| Attribute String | Modified regulatory region, Null/knockout | Gene | Del(4Nppb-Nppa)4Vmc |
| Strain of Origin | FVB/NRj | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | The Nppa and Nppb genes were targeted with sgRNAs (targeting GACTACATGGCAGATCACCC and GGCCAGTTCAAACGATTTGT) using CRISPR/Cas9 technology, resulting in the deletion of both genes and enhancer Rr103616 in-between, as well as the 3' end of the Gm13054 lncRNA gene. |
