|  Help  |  About  |  Contact Us

Allele : Del(4Nppb-Nppa)4Vmc deletion, Chr4, Vincent M Christoffels 4

Primary Identifier  MGI:7366921 Allele Type  Endonuclease-mediated
Attribute String  Modified regulatory region, Null/knockout Gene  Del(4Nppb-Nppa)4Vmc
Strain of Origin  FVB/NRj Is Recombinase  false
Is Wild Type  false
molecularNote  The Nppa and Nppb genes were targeted with sgRNAs (targeting GACTACATGGCAGATCACCC and GGCCAGTTCAAACGATTTGT) using CRISPR/Cas9 technology, resulting in the deletion of both genes and enhancer Rr103616 in-between, as well as the 3' end of the Gm13054 lncRNA gene.
  • mutations:
  • Intragenic deletion,
  • Intergenic deletion
  • synonyms:
  • Nppa-Nppb dKO,
  • Nppa-Nppb<->,
  • Nppa-Nppb<->,
  • Nppa-Nppb dKO
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

3 Publication categories

Trail: Allele