|  Help  |  About  |  Contact Us

Allele : Rr303<em1Vave> regulatory region 303; endonuclease-mediated mutation 1, Vasanth Vedantham

Primary Identifier  MGI:7367219 Allele Type  Endonuclease-mediated
Attribute String  Modified regulatory region Gene  Rr303
Is Recombinase  false Is Wild Type  false
molecularNote  The Isl1 sinoatrial node enhancer was targeted with sgRNAs (targeting TTGGAGAAAATCGAATACCC, CCCCAAACACAATATAGTAG, GCCAGTAATGTACTTCACTG and AGGGTGTGCACACTTACACA) using CRISPR/Cas9 technology, resulting in a 2762 bp deletion.
  • mutations:
  • Intergenic deletion
  • synonyms:
  • Isl1<deltaISE>,
  • Isl1<deltaISE>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

3 Publication categories