| Primary Identifier | MGI:7367487 | Allele Type | Endonuclease-mediated |
| Attribute String | Modified regulatory region | Gene | Rr305 |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | A C>T mutation was engineered in the highly conserved Fmr1 cis-regulatory element (CRE) using an sgRNA (targeting ACCTTGTGTCTATGACTATTTGG) and a ssODN template (TAAGATGGATTCATATTAGGGCTCAAATGCATTGATAGCATTCTACATATTTTTATCCATTTTTATTCCAAGCTACTTTTATCCAAATAGTTATAGACACAAGGTTATTGCAAATTGTATTTGTCTGCTGCCATAGT GCTTTCTATTTTAGAGGAGTAGAAGTAACTATCTCCTTAACAA) with CRISPR/Cas9 technology. The mutation mimics one found in some families with individuals presenting with X-linked intellectual disability (XLID). |
