| Primary Identifier | MGI:7384340 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence | Gene | Kcnma1 |
| Strain of Origin | C57BL/6J | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | CRISPR/Cas9 endonuclease-mediated genome editing was used with an sgRNA (targeting CTGTATGAAGTTACTGTTAT) and ssODN template (AGATACTAAGAAAAGTTGTAATTTGGACATCAATTGTGATTTTCGGTGTTGGCTTAAGAATGCTTCTCTTCTACCTTCTTTCTCCAGACATAtTTCAgTGACAATATtCTCACCCTAATACGGACCCTGGTGACAGGAGGAGCCACACCA) to change asparagine codon 995 (AAT) in exon 25 to serine (AGT) (ENSMUSP00000140033:p.N995S). This mutation is the equivalent of the human p.N999S mutation which, in heterozygous form, is the most common de novo KCNMA1 variant found in KCNMA1-linked channelopathy patients (17%), half of which develop seizures, paroxysmal non-kinesigenic dyskinesia (PKND3), or both. |