|  Help  |  About  |  Contact Us

Allele : Kcnma1<em1Alme> potassium large conductance calcium-activated channel, subfamily M, alpha member 1; endonuclease-mediated mutation 1, Andrea Meredith

Primary Identifier  MGI:7384340 Allele Type  Endonuclease-mediated
Attribute String  Humanized sequence Gene  Kcnma1
Strain of Origin  C57BL/6J Is Recombinase  false
Is Wild Type  false
molecularNote  CRISPR/Cas9 endonuclease-mediated genome editing was used with an sgRNA (targeting CTGTATGAAGTTACTGTTAT) and ssODN template (AGATACTAAGAAAAGTTGTAATTTGGACATCAATTGTGATTTTCGGTGTTGGCTTAAGAATGCTTCTCTTCTACCTTCTTTCTCCAGACATAtTTCAgTGACAATATtCTCACCCTAATACGGACCCTGGTGACAGGAGGAGCCACACCA) to change asparagine codon 995 (AAT) in exon 25 to serine (AGT) (ENSMUSP00000140033:p.N995S). This mutation is the equivalent of the human p.N999S mutation which, in heterozygous form, is the most common de novo KCNMA1 variant found in KCNMA1-linked channelopathy patients (17%), half of which develop seizures, paroxysmal non-kinesigenic dyskinesia (PKND3), or both.
  • mutations:
  • Single point mutation
  • synonyms:
  • Kcnma1<N999S>,
  • Kcnma1<N999S>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

2 Publication categories