|  Help  |  About  |  Contact Us

Allele : Rr322<em1Itan> regulatory region 322; endonuclease-mediated mutation 1, Ichiro Taniuchi

Primary Identifier  MGI:7384493 Allele Type  Endonuclease-mediated
Attribute String  Modified regulatory region Gene  Rr322
Is Recombinase  false Is Wild Type  false
molecularNote  The Ccl5 distal enhancer was targeted with sgRNAs (targeting ATCTTAGGATGACTCCACCC and GGAGTGGTTTAAATATAGGA) using CRISPR/Cas9 technology, resulting in a 512 bp deletion.
  • mutations:
  • Intergenic deletion
  • synonyms:
  • Ccl5<deltaDE>,
  • Ccl5<deltaDE>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories