| Primary Identifier | MGI:7385089 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Guk1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGCATAGCTGATAGGCTCCA and CATAGCAGTCCTGTGTAGGG, which resulted in a 429 bp deletion beginning at Chromosome 11 position 59,185,683 bp and ending after 59,186,111 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000104732 (exon 4) and 332 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 72 and early truncation 10 amino acids later. |
