| Primary Identifier | MGI:7385116 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Serpinb13 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGAAGAATAGAGATGTCCAT and GCATCTCTCCACGAATGCAG, which resulted in a 928 bp deletion beginning at Chromosome 1 position 106,995,664 bp and ending after 106,996,591 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001240769 and ENSMUSE00000253941 (exons 4 and 5) and 681 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause an early truncation after amino acid residue 74. |
