|  Help  |  About  |  Contact Us

Allele : Serpinb13<em1(IMPC)J> serine (or cysteine) peptidase inhibitor, clade B (ovalbumin), member 13; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:7385116 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Serpinb13
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGAAGAATAGAGATGTCCAT and GCATCTCTCCACGAATGCAG, which resulted in a 928 bp deletion beginning at Chromosome 1 position 106,995,664 bp and ending after 106,996,591 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001240769 and ENSMUSE00000253941 (exons 4 and 5) and 681 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause an early truncation after amino acid residue 74.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

2 Publication categories

Trail: Allele