|  Help  |  About  |  Contact Us

Allele : Eml3<em1(IMPC)J> echinoderm microtubule associated protein like 3; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:7386926 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Eml3
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CCAGTCAGCCTGCTAATGTG and GAACTACAGGAGTTCTAACG, which resulted in a 2241 bp deletion beginning at Chromosome 19 position 8,932,972 bp and ending after 8,935,212 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000621540, ENSMUSE00000621539, ENSMUSE00000621538, ENSMUSE00000621537, ENSMUSE00000621536, and ENSMUSE00000621535 (exons 5-10) and 1601 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 189 and early truncation 127 amino acids later.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

3 Publication categories